zgc:112072

Ensembl ID:
ENSDARG00000015425
ZFIN ID:
ZDB-GENE-050417-291
Description:
sodium/potassium/calcium exchanger 4 [Source:RefSeq peptide;Acc:NP_001017770]
Human Orthologue:
SLC24A4
Human Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 [Source:HGNC Symbol;Acc:1097
Mouse Orthologue:
Slc24a4
Mouse Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23145 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017560 Essential Splice Site 144 569 5 17
ENSDART00000141177 Essential Splice Site 177 602 5 17
Genomic Location (Zv9):
Chromosome 17 (position 38984379)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38869276
GRCz11 17 38816861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGGCAGCTGGAAGCTCCGCCCCTGAGCTGTTCGCCTCTATAATCGG[T/A]GAGCAACACGTGCAGGTGCTTATATGGGCATCAGTCATGTGTCAGCAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link