zgc:76988

Ensembl ID:
ENSDARG00000015352
ZFIN ID:
ZDB-GENE-030131-2184
Description:
Large subunit GTPase 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NY89]
Human Orthologue:
LSG1
Human Description:
large subunit GTPase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25652]
Mouse Orthologue:
Lsg1
Mouse Description:
large subunit GTPase 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:107236]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2609 Essential Splice Site F2 line generated During 2018
sa21946 Nonsense Available for shipment Available now
sa11790 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2609
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023867 Essential Splice Site 117 640 3 14
Genomic Location (Zv9):
Chromosome 11 (position 35031036)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33968109
GRCz11 11 34230541
KASP Assay ID:
554-3168.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAGAAACTCCATGAGGAAAACAAACAGCTTCTGCGAATCCCCCGAAG[G/A]TATTCTGATGTCTTATAATATGCATTTTTTCCTTACCTATATTAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023867 Nonsense 376 640 9 14
Genomic Location (Zv9):
Chromosome 11 (position 35035719)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33963426
GRCz11 11 34225858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAGAACTGTTAATATTCTAACTCTAAATTCTCTGCAAGGTTGGATA[T/A]CCAAATGTTGGGAAAAGCTCCACCATCAACACCATCTTTAGGAATAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023867 Nonsense 469 640 11 14
Genomic Location (Zv9):
Chromosome 11 (position 35036401)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33962744
GRCz11 11 34225176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAATACGTATGTCAGAATATCCCTCGAAATGTGCTGGAGGGSACTTA[C/A]GGAATCAACATCATCAGACCGAGGGARGACGAGGACCCTGATCGGCCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link