zc4h2

Ensembl ID:
ENSDARG00000015314
ZFIN ID:
ZDB-GENE-030131-2207
Description:
zinc finger C4H2 domain-containing protein [Source:RefSeq peptide;Acc:NP_955936]
Human Orthologue:
ZC4H2
Human Description:
zinc finger, C4H2 domain containing [Source:HGNC Symbol;Acc:24931]
Mouse Orthologue:
Zc4h2
Mouse Description:
zinc finger, C4H2 domain containing Gene [Source:MGI Symbol;Acc:MGI:2679294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38464 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33577 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020908 Essential Splice Site 187 224 4 5

The following transcripts of ENSDARG00000015314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23861229)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21574101
GRCz11 5 22077901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGCCAGGCAGACGGCAACGTTCCGACAGCAGCCGCCACCAATGAAG[G/A]TACGCAGACTTTTACATTGTCTACAGTAGTCAACCATTTGAGTGGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020908 Essential Splice Site 187 224 4 5

The following transcripts of ENSDARG00000015314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23861228)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21574100
GRCz11 5 22077900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGCCAGGCAGACGGCAACGTTCCGACAGCAGCCGCCACCAATGAAGG[T/A]ACGCAGACTTTTACATTGTCTACAGTAGTCAACCATTTGAGTGGATTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link