alpi

Ensembl ID:
ENSDARG00000015273
ZFIN ID:
ZDB-GENE-050327-78
Description:
intestinal-type alkaline phosphatase [Source:RefSeq peptide;Acc:NP_001014375]
Human Orthologues:
ALPI, ALPP, ALPPL2
Human Descriptions:
alkaline phosphatase, intestinal [Source:HGNC Symbol;Acc:437]
alkaline phosphatase, placental [Source:HGNC Symbol;Acc:439]
alkaline phosphatase, placental-like 2 [Source:HGNC Symbol;Acc:441]
Mouse Orthologues:
Akp3, Alpi, Alppl2
Mouse Descriptions:
alkaline phosphatase 3, intestine, not Mn requiring Gene [Source:MGI Symbol;Acc:MGI:87984]
alkaline phosphatase, intestinal Gene [Source:MGI Symbol;Acc:MGI:1924018]
alkaline phosphatase, placental-like 2 Gene [Source:MGI Symbol;Acc:MGI:108009]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32416 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015016 Nonsense 43 532 2 11
ENSDART00000104458 Nonsense 62 577 2 10
Genomic Location (Zv9):
Chromosome 22 (position 41808708)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38776701
GRCz11 22 38763446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGCTGTGCAGCTGAATGGGAGAAGGATCCCGCATACTGGAATGAT[C/T]AGGCCAGACGGACGCTGCAGACGGCCCTCACACTGCCTCTCAGAGTCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link