zgc:113074

Ensembl ID:
ENSDARG00000015230
ZFIN ID:
ZDB-GENE-050320-141
Description:
hypothetical protein LOC541437 [Source:RefSeq peptide;Acc:NP_001013580]
Human Orthologue:
PTBP2
Human Description:
polypyrimidine tract binding protein 2 [Source:HGNC Symbol;Acc:17662]
Mouse Orthologue:
Ptbp2
Mouse Description:
polypyrimidine tract binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860489]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37918 Essential Splice Site Available for shipment Available now
sa14689 Essential Splice Site Available for shipment Available now
sa24524 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046928   None 183 None 9
ENSDART00000123275 Essential Splice Site 36 512 4 14

The following transcripts of ENSDARG00000015230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 31685365)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 30918458
GRCz11 24 30855669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTCTCTCTATTCCCTGTATAATGTCCTCTTTCTGACCACTTTTGAC[A/T]GATACAACATCCAATGGCAGTGACAGCAAAAAACTCAGAGTTGAAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046928 Essential Splice Site 12 183 5 9
ENSDART00000123275 Essential Splice Site 341 512 10 14

The following transcripts of ENSDARG00000015230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 31697819)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 30906004
GRCz11 24 30843215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTCCTCTAAAGATGGTTACGCCCCACAGTCTGTTTACCCTCTTCGG[T/C]ATGTTCTCGTTAGCTCTACCTTTTTTTCATTTGGTTTCTCTTATTGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046928 Nonsense 151 183 9 9
ENSDART00000123275 Nonsense 480 512 14 14

The following transcripts of ENSDARG00000015230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 31704770)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 30899053
GRCz11 24 30836264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCATTTCTTTTCTCTGCAGAGATCATAAAATGGCCCTGATTCAGATGT[C/A]GACCATCGAAGAAGCCATTCAATGCCTGATCGACCTCCACAATTACAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Schizophrenia: Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link