atp6v0a1b

Ensembl ID:
ENSDARG00000015174
ZFIN ID:
ZDB-GENE-050522-215
Description:
ATPase, H+ transporting, lysosomal V0 subunit a isoform 1b [Source:RefSeq peptide;Acc:NP_001018502]
Human Orthologue:
ATP6V0A1
Human Description:
ATPase, H+ transporting, lysosomal V0 subunit a1 [Source:HGNC Symbol;Acc:865]
Mouse Orthologue:
Atp6v0a1
Mouse Description:
ATPase, H+ transporting, lysosomal V0 subunit A1 Gene [Source:MGI Symbol;Acc:MGI:103286]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45009 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45819 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041714 Essential Splice Site 634 839 16 22

The following transcripts of ENSDARG00000015174 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 7731724)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7589016
GRCz11 24 7618335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTCAACTACAACGACCCCACCAACAAACCGCTGTACAGAGGACAGG[T/G]AACACACATTAACGCAAAACAGAAGTTGTATTAATAGATCATTCTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041714 Nonsense 673 839 18 22

The following transcripts of ENSDARG00000015174 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 7724891)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7582183
GRCz11 24 7611502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGCAGACAGGCACCAGCTCACCCCCCGGACTCACCCAACAGGGCACA[C/T]AGAAGTTCGGTGGCGTCCGGGTCGGAAATGGGCCTACGGAGGACGAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link