
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
abcd3a
- Ensembl ID:
- ENSDARG00000015167
- ZFIN ID:
- ZDB-GENE-040426-2868
- Description:
- ATP-binding cassette sub-family D member 3 [Source:RefSeq peptide;Acc:NP_998647]
- Human Orthologue:
- ABCD3
- Human Description:
- ATP-binding cassette, sub-family D (ALD), member 3 [Source:HGNC Symbol;Acc:67]
- Mouse Orthologue:
- Abcd3
- Mouse Description:
- ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17682 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17682
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019318 | Essential Splice Site | 438 | 656 | 15 | 23 |
The following transcripts of ENSDARG00000015167 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 24 (position 31225641)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 31381963 GRCz11 24 31319174 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACTGGTGCCTGGAAGTGGAAGAATCATCAACATAGACAATATCRTCAAG[T/C]AAGAGTGGCTTCTCTCTGTCGCTGTATTTCAGTTTGGTGAACTATTTAWA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: