wasa

Ensembl ID:
ENSDARG00000015149
ZFIN ID:
ZDB-GENE-081104-419
Description:
Novel protein similar to H.sapiens WASL, Wiskott-Aldrich syndrome-like (WASL) [Source:UniProtKB/TrEM
Human Orthologue:
WAS
Human Description:
Wiskott-Aldrich syndrome (eczema-thrombocytopenia) [Source:HGNC Symbol;Acc:12731]
Mouse Orthologue:
Was
Mouse Description:
Wiskott-Aldrich syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:105059]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34409 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026807 Nonsense 59 630 2 11
ENSDART00000140152 Nonsense 59 442 2 9
ENSDART00000141431   None 159 None 3

The following transcripts of ENSDARG00000015149 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26488006)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25615924
GRCz11 8 25635063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTGCTTATGGCTCTTCCGAGCGACCCGAATCGATGGACACCACAA[C/T]AATCTGGAGTTGTTTGTTTCGTCAAGGACAGTTCTCTGCGCTCCTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link