zgc:194737

Ensembl ID:
ENSDARG00000015134
ZFIN ID:
ZDB-GENE-080722-13
Description:
hypothetical protein LOC100170786 [Source:RefSeq peptide;Acc:NP_001124097]
Human Orthologue:
CAMKK1
Human Description:
calcium/calmodulin-dependent protein kinase kinase 1, alpha [Source:HGNC Symbol;Acc:1469]
Mouse Orthologue:
Camkk1
Mouse Description:
calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene [Source:MGI Symbol;Acc:MGI:1891766]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42506 Nonsense Mutation detected in F1 DNA During 2018
sa16462 Essential Splice Site Available for shipment Available now
sa22600 Essential Splice Site Available for shipment Available now
sa28418 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125864 Nonsense 18 484 1 16
Genomic Location (Zv9):
Chromosome 15 (position 14335411)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15380374
GRCz11 15 15316396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGCTGACACAGCCAGCAGACTGGATCTAGACTCTGATTATCATGCT[G/T]AACTGGCGGACATGGTGGCAGCCATGAGTGTGGCTGCCACCAGACTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125864 Essential Splice Site 204 484 8 16
Genomic Location (Zv9):
Chromosome 15 (position 14342705)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15387668
GRCz11 15 15323690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTNNTTAGTTTAGATTTTCTGTATTTTTTACTTCTTCTCCTGCCTGGTTCTA[G/A]CCCAGTGATGGAGGTCCCGACAGACAGCCCTCTAWCAGAAGAAATGGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125864 Essential Splice Site 300 484 9 16
Genomic Location (Zv9):
Chromosome 15 (position 14343088)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15388051
GRCz11 15 15324073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGCACCTGAAACACTGACGGATCAGGACCAAAGATTCAGTGGAAAGG[T/G]AAGAAGAGTTGTTATGTTGGCTTTCAAGCATGAAAAACACAAAAAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125864 Essential Splice Site 459 484 16 16
Genomic Location (Zv9):
Chromosome 15 (position 14349996)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15394959
GRCz11 15 15330981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTTGTGTTTGCGTCTATCTTCATATTTTGCTGGTGTGTGTCTCCAAC[A/T]GCAGAGGGAGTAACAGTAACAGTAACGGGAGCAGAGAAGGGGAGCTGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link