zgc:101000

Ensembl ID:
ENSDARG00000015123
ZFIN ID:
ZDB-GENE-040808-35
Description:
hypothetical protein LOC445317 [Source:RefSeq peptide;Acc:NP_001003774]
Human Orthologues:
DNASE1L1, DNASE1L3
Human Descriptions:
deoxyribonuclease I-like 1 [Source:HGNC Symbol;Acc:2957]
deoxyribonuclease I-like 3 [Source:HGNC Symbol;Acc:2959]
Mouse Orthologues:
Dnase1l1, Dnase1l3
Mouse Descriptions:
deoxyribonuclease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:109628]
deoxyribonuclease 1-like 3 Gene [Source:MGI Symbol;Acc:MGI:1314633]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32368 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012686 Essential Splice Site 264 288 8 10
ENSDART00000127685 Essential Splice Site 271 311 9 11
ENSDART00000127688 Essential Splice Site 248 272 8 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 5593037)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5639104
GRCz11 22 5668950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGAAACCGTTCAACTTCCAGACTGCCTTCAGCTTGACAGAGGAAGAT[G/A]TAAACAAGAATGATTTCATACTCATATGTAACACAGGACCACAAAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link