Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ddx39b
- Ensembl ID:
- ENSDARG00000015111
- ZFIN ID:
- ZDB-GENE-040426-2902
- Description:
- ATP-dependent RNA helicase DDX39 [Source:RefSeq peptide;Acc:NP_998142]
- Human Orthologue:
- DDX39
- Human Description:
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 [Source:HGNC Symbol;Acc:17821]
- Mouse Orthologue:
- Ddx39
- Mouse Description:
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI Symbol;Acc:MGI:1915528]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa19934 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19934
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000019957 | Nonsense | 412 | 427 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 3 (position 6141451)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 5713894 GRCz11 3 5623815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGCCAAGATCCTGAACGACGTGCAGGACAGATTTGAGGTCAACGTGGCC[G/T]AGTTACCGGAGGAGATCGACATTTCCACTTACAGTGAGTCTGCAGTCTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
