slc18a2

Ensembl ID:
ENSDARG00000015110
ZFIN ID:
ZDB-GENE-080514-1
Description:
Slc18a2 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZP4]
Human Orthologue:
SLC18A2
Human Description:
solute carrier family 18 (vesicular monoamine), member 2 [Source:HGNC Symbol;Acc:10935]
Mouse Orthologue:
Slc18a2
Mouse Description:
solute carrier family 18 (vesicular monoamine), member 2 Gene [Source:MGI Symbol;Acc:MGI:106677]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36403 Nonsense Mutation detected in F1 DNA During 2018
sa36404 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6475 Nonsense Mutation detected in F1 DNA During 2018
sa12325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Nonsense 130 561 3 16
Genomic Location (Zv9):
Chromosome 17 (position 23614392)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23764541
GRCz11 17 23784565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCCCTCTTTCTCCATCGAGCACCTTTCAGAGCATTGTGTCTTTGTA[T/A]GACAACACCACACGTGTGACAGGCTTCAGCCCGCAGATGAGCACAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Essential Splice Site 222 561 4 16
Genomic Location (Zv9):
Chromosome 17 (position 23615580)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23765729
GRCz11 17 23785753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCCCAATGTTTGCTGGTTTCTGCATCATGTTTGTTTCTACGATCAG[T/C]GAGTACATAAAACATATATATTTTTAATGCTGCTTTTAACATTAATCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Nonsense 264 561 6 16
Genomic Location (Zv9):
Chromosome 17 (position 23618898)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23769047
GRCz11 17 23789071
KASP Assay ID:
554-5475.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGTAGGTATGGGGATGCTGGCAAGTGTTTAHACAGATGACGAGGAA[C/T]GAGGAAACGCTATTGGGATTGCACTGGGAGGACTAGCAATGGGAGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Nonsense 514 561 15 16
Genomic Location (Zv9):
Chromosome 17 (position 23633732)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23783881
GRCz11 17 23803905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTCATGACCATCATCGGTTTAGTGGACATCAKGTTTGCTCCTCTTTG[T/A]TTCTTTCTGCGAAATCCTCCCGCCAACGAGGAAAAGATGGTTAGAATYCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link