zgc:100980

Ensembl ID:
ENSDARG00000015091
ZFIN ID:
ZDB-GENE-040718-239
Description:
hypothetical protein LOC437012 [Source:RefSeq peptide;Acc:NP_001002739]
Human Orthologue:
C17orf28
Human Description:
chromosome 17 open reading frame 28 [Source:HGNC Symbol;Acc:15736]
Mouse Orthologue:
C630004H02Rik
Mouse Description:
RIKEN cDNA C630004H02 gene Gene [Source:MGI Symbol;Acc:MGI:2445087]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35375 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24922 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027032 Essential Splice Site 624 803 14 20
Genomic Location (Zv9):
Chromosome 12 (position 47635708)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 46264947
GRCz11 12 46565939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACCAGCTCAAACAGGCACTCTGAACGCAAGCTTGAAGGACATACCAC[G/A]TATGTGAATCACAGCTTCTGTATGTTAATAAGTATAAATTACAACAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027032 Essential Splice Site 783 803 20 20
Genomic Location (Zv9):
Chromosome 12 (position 47649407)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 46278647
GRCz11 12 46579639
KASP Assay ID:
554-7482.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTACATGTTAAAATGTGGTATAACATGATGTGTTTGTTGTTGTTTTA[G/A]TAATGTGGATCCTCCTGTTTGGTACGACACTGATGTCAAGCTGTTTGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link