wu:fi14a03

Ensembl ID:
ENSDARG00000015065
ZFIN IDs:
ZDB-GENE-030131-5697, ZDB-GENE-030131-5697
Description:
Wu:fi14a03 protein [Source:UniProtKB/TrEMBL;Acc:A6H8S2]
Human Orthologues:
C4A, C4B
Human Descriptions:
complement component 4A (Rodgers blood group) [Source:HGNC Symbol;Acc:1323]
complement component 4B (Chido blood group) [Source:HGNC Symbol;Acc:1324]
Mouse Orthologue:
C4b
Mouse Description:
complement component 4B (Childo blood group) Gene [Source:MGI Symbol;Acc:MGI:88228]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22687 Nonsense Available for shipment Available now
sa22686 Nonsense Available for shipment Available now
sa45548 Nonsense Mutation detected in F1 DNA During 2018
sa35937 Nonsense Mutation detected in F1 DNA During 2018
sa45547 Nonsense Mutation detected in F1 DNA During 2018
sa35936 Essential Splice Site Available for shipment Available now
sa35935 Nonsense Mutation detected in F1 DNA During 2018
sa42584 Nonsense Mutation detected in F1 DNA During 2018
sa22685 Nonsense Available for shipment Available now
sa12226 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 267 1700 8 41
ENSDART00000125214 Nonsense 267 942 8 23
Genomic Location (Zv9):
Chromosome 15 (position 31627454)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32523106
GRCz11 15 32381085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTCAGATATACTTATGGAAAGGGGGTCAATGGGATTGCATATGTT[C/T]GATTTGGACTTGTTGATGAAAAGCACAATAAGATATATCTTCCAGGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 286 1700 8 41
ENSDART00000125214 Nonsense 286 942 8 23
Genomic Location (Zv9):
Chromosome 15 (position 31627397)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32523049
GRCz11 15 32381028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTGTTGATGAAAAGCACAATAAGATATATCTTCCAGGCACTGAAAAG[C/T]AGATAACTGTGAGTAAAAAATTGCAGTAAAATGTTTGTGATAACAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 400 1700 11 41
ENSDART00000125214 Nonsense 400 942 11 23
Genomic Location (Zv9):
Chromosome 15 (position 31625153)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32520805
GRCz11 15 32378784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAATTTACAGCCACCATAACAATTGATGGATCATCAGAGCAGATTCTG[C/T]AAAACGAAAGCTGGGGAAATGAAATGGGAGATGTTGCCATGTCTTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 614 1700 15 41
ENSDART00000125214 Nonsense 614 942 15 23
Genomic Location (Zv9):
Chromosome 15 (position 31622885)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32518537
GRCz11 15 32376516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGGGGGGATTTGTTTTGCACACAGATGTTTGATTATATGAACTCGTA[T/A]GACCTGGCCTGCTCTGTTGGAGGAGGAGAGGATTCTAGTGCTGTTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 845 1700 20 41
ENSDART00000125214 Nonsense 845 942 20 23
Genomic Location (Zv9):
Chromosome 15 (position 31619903)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32515555
GRCz11 15 32373534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGAAGAGAAACGAACAGCTTCAGGTTAAAGCTGTTGTGTACAATTA[C/A]AAGCAGGAGAGTTTAAAGGTAAGCTTCCGGGTGCTTTTCTTGCAAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Essential Splice Site 919 1700 21 41
ENSDART00000125214 Essential Splice Site 919 942 21 23
Genomic Location (Zv9):
Chromosome 15 (position 31619550)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32515202
GRCz11 15 32373181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTTCCGAAATCATCCATGATCGAGTCGAAAAGAAACTTCGTGTGGAG[G/A]TAAAGTATGTTCATTTTTTAGATATTAATATATTTTACAAATGCTACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 970 1700 24 41
ENSDART00000125214   None 942 None 23
Genomic Location (Zv9):
Chromosome 15 (position 31617249)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32512901
GRCz11 15 32370880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTTTAGATACAGTCAGTGCTGTCTCTGTTTCAGGTGGAGTGATGGGC[G/T]AGTCAATAGACAACTGTTTAAACCTGGAGGGTATTGATAAACTGATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 1206 1700 29 41
ENSDART00000125214   None 942 None 23
Genomic Location (Zv9):
Chromosome 15 (position 31612717)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32508369
GRCz11 15 32366348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTAGCTCAGTTATCATATTTTCTGTTTCATGTAGAAATGTGTTTTTG[G/A]AAAGCCAAGGGTGGCAGAGGTGAACCAAAAGATAAAGCTGATGCTCGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Nonsense 1366 1700 32 41
ENSDART00000125214   None 942 None 23
Genomic Location (Zv9):
Chromosome 15 (position 31608091)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32503743
GRCz11 15 32361722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTGATCTTTTTCACCTTACTGTCACAGTGAAGGGAGAGCTGGAGTA[C/A]AGTATGTAACATTAAGGGACACTTTCATCGTAGGACACTCTATTGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028349 Essential Splice Site 1455 1700 34 41
ENSDART00000125214   None 942 None 23
Genomic Location (Zv9):
Chromosome 15 (position 31607549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTTCTCTTCTGAGTGGACTGATACCAAACAGCAAAGACCTGGAACAT[G/A]TGCATATTATCTATCTATCTATCTATCTATCTRTCTRWCTRTCTRTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link