ube2d4

Ensembl ID:
ENSDARG00000015057
ZFIN ID:
ZDB-GENE-070424-86
Description:
ubiquitin-conjugating enzyme E2 D4 [Source:RefSeq peptide;Acc:NP_001082922]
Human Orthologue:
UBE2D4
Human Description:
ubiquitin-conjugating enzyme E2D 4 (putative) [Source:HGNC Symbol;Acc:21647]
Mouse Orthologue:
Gm5959
Mouse Description:
predicted gene 5959 Gene [Source:MGI Symbol;Acc:MGI:3644823]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34515 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098439 Essential Splice Site 66 147 4 7
Genomic Location (Zv9):
Chromosome 8 (position 54571187)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52306059
GRCz11 8 52292588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCTCACGATTCACTTCCCAACAGACTACCCATTTAAACCACCAAAG[G/A]TCAGTCCATCTGTGATGTTCATTGCGTTTTGAGGCCATCAGTCTAATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link