
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
grip1
- Ensembl ID:
- ENSDARG00000015053
- ZFIN ID:
- ZDB-GENE-041210-125
- Description:
- glutamate receptor-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001038316]
- Human Orthologue:
- GRIP1
- Human Description:
- glutamate receptor interacting protein 1 [Source:HGNC Symbol;Acc:18708]
- Mouse Orthologue:
- Grip1
- Mouse Description:
- glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40251 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa17341 | Essential Splice Site | Available for shipment | Available now |
sa33422 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40251
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026593 | Nonsense | 32 | 1143 | 1 | 24 |
- Genomic Location (Zv9):
- Chromosome 4 (position 12320129)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 13256756 GRCz11 4 13255605 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACGCAAAGGCAAAAAGTACCGCCCTGAAGAGGATTACCATGAGGGTTA[C/A]GAGGACGTGTATTACTATGCTTCTGAGCACCTGCACCGTAAGTGCTACCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17341
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026593 | Essential Splice Site | 45 | 1143 | 2 | 24 |
- Genomic Location (Zv9):
- Chromosome 4 (position 12221004)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 13157631 GRCz11 4 13156480 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGAGACAAGGTTTTGCTAATGTGTGGTTTTTAAATGCCTTGTGTTTTTC[A/G]GATGAGGGGCCCTACACTAAACACTCCAATCCCTCCAGGCCACCAGATGS
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33422
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026593 | Essential Splice Site | 421 | 1143 | 10 | 24 |
- Genomic Location (Zv9):
- Chromosome 4 (position 12175410)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 13112037 GRCz11 4 13110886 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCCGACCAGTCCCACAGCCAGGCCAAGAAAACCTCTCCAAGCAACCCCC[G/A]TAATGTTTCTTCCCTTTTTCCTTCATCCTCATGTGTCCCTCCTTGTCTAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: