slc23a1

Ensembl ID:
ENSDARG00000015033
ZFIN ID:
ZDB-GENE-080804-2
Description:
solute carrier family 23 member 1 [Source:RefSeq peptide;Acc:NP_001166970]
Human Orthologue:
SLC23A1
Human Description:
solute carrier family 23 (nucleobase transporters), member 1 [Source:HGNC Symbol;Acc:10974]
Mouse Orthologue:
Slc23a1
Mouse Description:
solute carrier family 23 (nucleobase transporters), member 1 Gene [Source:MGI Symbol;Acc:MGI:1341903

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30723 Nonsense Mutation detected in F1 DNA During 2018
sa23969 Nonsense Available for shipment Available now
sa16168 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014223 Nonsense 73 635 2 14
Genomic Location (Zv9):
Chromosome 21 (position 28849154)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30068398
GRCz11 21 30105093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCATCTTTTGATATGATCTACAGGATCGAGGACGTCCCGCCTTGGTA[T/A]CTGTGTATCCTGCTGGGACTGCAGGTTTACACTTATTTTCTCTTCTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014223 Nonsense 281 635 7 14
Genomic Location (Zv9):
Chromosome 21 (position 28842112)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30061356
GRCz11 21 30098051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTCTCCCAAGCTTTTCTAAAGAAAAAGGCTGTCATATAACCCACGTC[C/T]AAATTTTCAAGATGTTTCCGGTATGAACCAATATTCAACGCTCAGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014223 Essential Splice Site 547 635 13 14
Genomic Location (Zv9):
Chromosome 21 (position 28836325)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30055569
GRCz11 21 30092264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTTTGTTGGGGGATTCTTAGCATTTGTACTWGACAACACAATCCCAG[G/A]TATAACCGTGGACTTWTYCTTCAGATAATAAGMCAAYAAAGACAATTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link