
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nadl1.1
- Ensembl ID:
- ENSDARG00000015025
- ZFIN ID:
- ZDB-GENE-980526-512
- Description:
- Neural cell adhesion molecule L1.1 [Source:UniProtKB/Swiss-Prot;Acc:Q90478]
- Human Orthologue:
- L1CAM
- Human Description:
- L1 cell adhesion molecule [Source:HGNC Symbol;Acc:6470]
- Mouse Orthologue:
- L1cam
- Mouse Description:
- L1 cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:96721]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12283 | Nonsense | Available for shipment | Available now |
sa756 | Essential Splice Site | Available for shipment | Available now |
sa39389 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa37581 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12283
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026177 | Nonsense | 664 | 1264 | 17 | 33 |
ENSDART00000055130 | Nonsense | 619 | 1224 | 14 | 26 |
ENSDART00000055131 | Nonsense | 664 | 1269 | 17 | 29 |
ENSDART00000132175 | Nonsense | 727 | 1332 | 17 | 29 |
The following transcripts of ENSDARG00000015025 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 623496)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 594487 GRCz11 23 607280 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGTATGTGATTGAGATGAACGAGGGGGAGACTCCAGWCGAGGGTCAAT[G/A]GCAGAAATACAGGAGTGTTTCTCAGGACATCCGWCAGCTGGAGWTCCACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa756
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026177 | Essential Splice Site | 681 | 1264 | 19 | 33 |
ENSDART00000055130 | 638 | 1224 | 14 | 26 | |
ENSDART00000055131 | 683 | 1269 | 17 | 29 | |
ENSDART00000132175 | 746 | 1332 | 17 | 29 |
The following transcripts of ENSDARG00000015025 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 623438)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 594429 GRCz11 23 607222 - KASP Assay ID:
- 554-0663.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACAGGAGTGTTTCTCAGGACATCCGWCAGCTGGAGATCCACCTGCAGCC[C/A]TACAGCAAATACCACTTCCAGATCCGGGCAGTSAACAGCATAGGAACCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39389
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026177 | Essential Splice Site | 1058 | 1264 | 29 | 33 |
ENSDART00000055130 | Essential Splice Site | 1018 | 1224 | 22 | 26 |
ENSDART00000055131 | Essential Splice Site | 1063 | 1269 | 25 | 29 |
ENSDART00000132175 | Essential Splice Site | 1126 | 1332 | 25 | 29 |
The following transcripts of ENSDARG00000015025 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 617518)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 588509 GRCz11 23 601302 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAAGACAGTTCTGCAGCTAATAATATTATATTAATACTAATGTTTTCGC[A/T]GAGGGTGCTGAATGGGAAGAGTCGGAGAAGATCAACTCCACACAGGCCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37581
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026177 | Essential Splice Site | 1107 | 1264 | 29 | 33 |
ENSDART00000055130 | Essential Splice Site | 1067 | 1224 | 22 | 26 |
ENSDART00000055131 | Essential Splice Site | 1112 | 1269 | 25 | 29 |
ENSDART00000132175 | Essential Splice Site | 1175 | 1332 | 25 | 29 |
The following transcripts of ENSDARG00000015025 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 23 (position 617366)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 588357 GRCz11 23 601150 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCCGGAAACACTTCTTATGACTGGGATTTCAAAACGATATACAGGCGAG[G/A]TACGCTCTCACGCTTATTTATTTACTGTTGTGCTTGTTGGTTATGAGCAA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: