zgc:101737

Ensembl ID:
ENSDARG00000015010
ZFIN ID:
ZDB-GENE-041114-110
Description:
hypothetical protein LOC492767 [Source:RefSeq peptide;Acc:NP_001007409]
Human Orthologue:
CCDC114
Human Description:
coiled-coil domain containing 114 [Source:HGNC Symbol;Acc:26560]
Mouse Orthologue:
Ccdc114
Mouse Description:
coiled-coil domain containing 114 Gene [Source:MGI Symbol;Acc:MGI:2446120]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8591 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023745 Nonsense 424 566 12 15
ENSDART00000127921 Nonsense 424 566 11 14
Genomic Location (Zv9):
Chromosome 11 (position 42192373)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40452154
GRCz11 11 40716299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATGTGGTTGTAGGGATTGACAGTGTGTTCAGTAAGATGGACTGYGAT[C/T]GAGCGCTRATGGACGAYATGTTGGGCTCTTCTTCTGGGATCAGAGACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link