
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dnm1l
- Ensembl ID:
- ENSDARG00000015006
- ZFIN ID:
- ZDB-GENE-040426-1556
- Description:
- Dynamin-1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q7SXN5]
- Human Orthologue:
- DNM1L
- Human Description:
- dynamin 1-like [Source:HGNC Symbol;Acc:2973]
- Mouse Orthologue:
- Dnm1l
- Mouse Description:
- dynamin 1-like Gene [Source:MGI Symbol;Acc:MGI:1921256]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44293 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24668 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44293
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006840 | Nonsense | 116 | 691 | 4 | 18 |
ENSDART00000133860 | None | 94 | None | 3 | |
ENSDART00000145987 | None | 228 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20739494)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 20150283 GRCz11 25 20247937 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTACACAGATTTTGATGAAATCAGGCAAGAAATTGAAAATGAAACAGAA[A/T]GAGTTTCTGGCAATAACAAGGTACAAAGTCACGTGATGTTTTTTGCACAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24668
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006840 | Nonsense | 127 | 691 | 5 | 18 |
ENSDART00000133860 | None | 94 | None | 3 | |
ENSDART00000145987 | None | 228 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20736903)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 20147692 GRCz11 25 20245346 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATATCCTTAAAATCCCTCTTGTGTCATTTTTTCTTAGGGCATCAGTGAT[G/T]AGCCCATACACCTGAAAATCTTCTCTCCACATGTTGTCAACCTCACGCTG
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: