zgc:112257

Ensembl ID:
ENSDARG00000014976
ZFIN ID:
ZDB-GENE-050522-56
Description:
hypothetical protein LOC553696 [Source:RefSeq peptide;Acc:NP_001018506]
Human Orthologues:
AC108938.4, LIMS1, LIMS3
Human Descriptions:
LIM and senescent cell antigen-like domains 1 [Source:HGNC Symbol;Acc:6616]
LIM and senescent cell antigen-like domains 3 [Source:HGNC Symbol;Acc:30047]
LIM and senescent cell antigen-like-containing domain protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q9H
Mouse Orthologue:
Lims1
Mouse Description:
LIM and senescent cell antigen-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:1195263]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44697 Nonsense Mutation detected in F1 DNA During 2018
sa34535 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006099 Nonsense 257 377 6 11
ENSDART00000147882 Nonsense 213 333 5 10
Genomic Location (Zv9):
Chromosome 9 (position 426946)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 119278
GRCz11 9 97847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGAGACCAGTGGAGGGACGAGTGGTCAACGCCATGGGGAAACAGT[G/A]GCACGTGGAGGTACACACACACACACACACGCACACGCACGCACACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006099 Essential Splice Site 307 377 8 11
ENSDART00000147882 Essential Splice Site 263 333 7 10
Genomic Location (Zv9):
Chromosome 9 (position 426545)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 118877
GRCz11 9 97446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTTCGGGGACGTCTGCTTTCAGTGTAACCGTGTGATCGAGGGTGACG[G/A]TGAGTTGCATTTACACTGAGTGTGTGTGTGTGTGTGTACCTGCTGACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link