zgc:66477

Ensembl ID:
ENSDARG00000014966
ZFIN ID:
ZDB-GENE-030131-5749
Description:
coiled-coil domain-containing protein 82 [Source:RefSeq peptide;Acc:NP_956116]
Human Orthologue:
CCDC82
Human Description:
coiled-coil domain containing 82 [Source:HGNC Symbol;Acc:26282]
Mouse Orthologue:
Ccdc82
Mouse Description:
coiled-coil domain containing 82 Gene [Source:MGI Symbol;Acc:MGI:1913646]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24023 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017709 Nonsense 320 506 5 8
ENSDART00000143594 Nonsense 126 312 3 6
Genomic Location (Zv9):
Chromosome 21 (position 39348601)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40677063
GRCz11 21 40700110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTGACCCACATATTTCTTACTTTGCATCAATGTCTACAGGTGGCGAA[C/T]GAACAAAGCGATACGCCCAGGAGATGAAAACATCATTGCTTCATTTTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link