zgc:158776

Ensembl ID:
ENSDARG00000014956
ZFIN ID:
ZDB-GENE-070112-202
Description:
Novel protein (Zgc:158776) [Source:UniProtKB/TrEMBL;Acc:B8JI27]
Human Orthologue:
DIABLO
Human Description:
diablo homolog (Drosophila) [Source:HGNC Symbol;Acc:21528]
Mouse Orthologue:
Diablo
Mouse Description:
diablo homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913843]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43631 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45736 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014254   None 247 None 6
ENSDART00000142690 Essential Splice Site 1 175 1 5
Genomic Location (Zv9):
Chromosome 21 (position 20413854)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21490024
GRCz11 21 21526660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGACACCGGCCCTCCAGGACCAGGATTGGTGACCCCTGCATTAGATGG[T/A]TTGTCAAGCCCCCTTACATGTATAACATATAACATATATAATATATAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014254 Nonsense 245 247 6 6
ENSDART00000142690 Nonsense 173 175 5 5
Genomic Location (Zv9):
Chromosome 21 (position 20410649)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21486819
GRCz11 21 21523455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCAGGTGGCCCTCAGTGAGGATGAGGATATCCCAGATGCATATCTA[C/T]GAGAGGACTAGTTGAATCAAGCCCTTTTAACACAGCCTTAAAACACACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link