svopb

Ensembl ID:
ENSDARG00000014951
ZFIN ID:
ZDB-GENE-070705-359
Human Orthologue:
SVOP
Human Description:
SV2 related protein homolog (rat) [Source:HGNC Symbol;Acc:25417]
Mouse Orthologue:
Svop
Mouse Description:
SV2 related protein Gene [Source:MGI Symbol;Acc:MGI:1915916]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14387 Essential Splice Site Available for shipment Available now
sa18276 Nonsense Available for shipment Available now
sa33635 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049178 Essential Splice Site 14 411 3 14
Genomic Location (Zv9):
Chromosome 5 (position 33578664)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31340896
GRCz11 5 31941049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTATATACCTTTAATTGGAACACTTTAATTGGATATCTTTTTAGGT[A/G]GTRTTCGTTGGGATGATGCTCAGTTCCAYGTTTTGGGGAAACATTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049178 Nonsense 122 411 6 14
Genomic Location (Zv9):
Chromosome 5 (position 33576388)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31338620
GRCz11 5 31938773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGTTTGAGGTGGTTCTGGCTATACTGGTCATGCCCACATTAGGCTG[G/A]AAATGGCTGCTGGCTTTCACTAACCTTCCTCTGCTTGTGTTTGCTGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049178 Essential Splice Site 306 411 12 14
Genomic Location (Zv9):
Chromosome 5 (position 33569955)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31332187
GRCz11 5 31932340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTGACGTGACTGAAAATGACAACATGTTTATCTCTTGACTATTTCC[A/T]GAATAGTTCTCACAGTCTTTATTTTCATTGCTCGAACCAGCATCAATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link