zgc:136560

Ensembl ID:
ENSDARG00000014875
ZFIN ID:
ZDB-GENE-060519-5
Description:
abl interactor 2 [Source:RefSeq peptide;Acc:NP_001038762]
Human Orthologue:
ABI2
Human Description:
abl-interactor 2 [Source:HGNC Symbol;Acc:24011]
Mouse Orthologue:
Abi2
Mouse Description:
abl-interactor 2 Gene [Source:MGI Symbol;Acc:MGI:106913]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20645 Essential Splice Site Available for shipment Available now
sa16444 Essential Splice Site Available for shipment Available now
sa18833 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065471 Essential Splice Site 154 461 3 9
Genomic Location (Zv9):
Chromosome 6 (position 9893971)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9747778
GRCz11 6 9983317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCCCATTGACTACAGTCTGCTGGATGACGTAGGCCATGGCGTAAAG[G/T]TAGGCATCAAGCCAGTCTCTATGTGTGAGTTCATGTTGTTATATTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065471 Essential Splice Site 340 461 7 9
ENSDART00000065471 Essential Splice Site 340 461 7 9
Genomic Location (Zv9):
Chromosome 6 (position 9914375)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9768182
GRCz11 6 10003721
KASP Assay ID:
2259-7191.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATACAAAACCAGCTTAATGGAGGGCCACACTACAACCAAAACCAAGR[T/G]AAAGACCACACAGCCCTCTGTTGTGTAATCAAAGTTATCTATAAGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065471 Essential Splice Site 340 461 7 9
ENSDART00000065471 Essential Splice Site 340 461 7 9
Genomic Location (Zv9):
Chromosome 6 (position 9914375)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9768182
GRCz11 6 10003721
KASP Assay ID:
2259-7191.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATACAAAACCAGCTTAATGGAGGGCCACACTACAACCAAAACCAAGG[T/G]AAAGACCACACAGCCCTCTGTTGTGTAATCAAAGTTATCTATAAGGTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link