syngr3

Ensembl ID:
ENSDARG00000014871
ZFIN ID:
ZDB-GENE-050522-541
Description:
synaptogyrin 3 [Source:RefSeq peptide;Acc:NP_001018427]
Human Orthologue:
SYNGR3
Human Description:
synaptogyrin 3 [Source:HGNC Symbol;Acc:11501]
Mouse Orthologue:
Syngr3
Mouse Description:
synaptogyrin 3 Gene [Source:MGI Symbol;Acc:MGI:1341881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33268 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011568 Essential Splice Site 161 228 3 4
Genomic Location (Zv9):
Chromosome 3 (position 40171746)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40035106
GRCz11 3 40176964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGCCAGAGCTGCCATAACCTTCTCCTTCTTCTCCATCTTCACCTGG[G/A]TAACTCAACAAATAAAAGCACATTTATTGTCTTTTTATGAGAGTAATTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link