smchd1

Ensembl ID:
ENSDARG00000014836
ZFIN ID:
ZDB-GENE-050211-6
Description:
KIAA0650-like protein [Source:UniProtKB/TrEMBL;Acc:Q5I9I5]
Human Orthologue:
SMCHD1
Human Description:
structural maintenance of chromosomes flexible hinge domain containing 1 [Source:HGNC Symbol;Acc:290
Mouse Orthologue:
Smchd1
Mouse Description:
SMC hinge domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921605]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18180 Nonsense Available for shipment Available now
sa34256 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016267 Nonsense 57 401 2 10
Genomic Location (Zv9):
Chromosome 7 (position 75321968)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71436796
GRCz11 7 71629230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTGGATTTAAGTGTTTGTAKYAAAGYTGCTCTCTGTAATTCAGCCTT[T/A]GCAGGTCATGAATGGTCATGSTTTGGAGACTCCRCTGACMATGCAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016267 Nonsense 278 401 8 10
Genomic Location (Zv9):
Chromosome 7 (position 75314260)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71444504
GRCz11 7 71636598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGTTTCGGTCTTAGATTCCACTGAATGTATTTGCCAATAAAGCCACG[A/T]AGTTAGCCCCTGAGATTCCACCTGCTACTCCTGTTGTGTCCAATAGTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link