fau

Ensembl ID:
ENSDARG00000014830
ZFIN ID:
ZDB-GENE-040426-1700
Description:
40S ribosomal protein S30 [Source:RefSeq peptide;Acc:NP_957031]
Human Orthologues:
AP000769.1, FAU
Human Descriptions:
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed [Source:HGNC Symbol;Acc:
Putative ubiquitin-like protein FUBI-like protein ENSP00000310146 [Source:UniProtKB/Swiss-Prot;Acc:A
Mouse Orthologues:
Fau, Gm9843
Mouse Descriptions:
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived) Gene [Sour
predicted gene 9843 Pseudogene [Source:MGI Symbol;Acc:MGI:3708621]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45721 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007334 Essential Splice Site 95 136 4 5
ENSDART00000125773 Essential Splice Site 92 133 4 5
ENSDART00000148362 Essential Splice Site 92 133 4 5
Genomic Location (Zv9):
Chromosome 20 (position 54593354)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54520876
GRCz11 20 54202977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGGCTCTCTGGCTCGCGCTGGTAAAGTAAGAGGACAGACGCCTAAGG[T/C]AAGTCCCGTCTGCAGTGCTGTGATCTTCAGCTCACTGCGTTTACTACGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link