
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:92375
- Ensembl ID:
- ENSDARG00000014805
- ZFIN ID:
- ZDB-GENE-040822-3
- Description:
- hypothetical protein LOC445475 [Source:RefSeq peptide;Acc:NP_001004112]
- Human Orthologue:
- FHL5
- Human Description:
- four and a half LIM domains 5 [Source:HGNC Symbol;Acc:17371]
- Mouse Orthologue:
- Fhl5
- Mouse Description:
- four and a half LIM domains 5 Gene [Source:MGI Symbol;Acc:MGI:1913192]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32141 | Essential Splice Site | Available for shipment | Available now |
sa45598 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa337 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa165 | Nonsense | F2 line generated | During 2018 |
sa23027 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32141
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010496 | Essential Splice Site | 53 | 280 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 17 (position 15452550)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 15603378 GRCz11 17 15611311 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCAACTGCTGCGAGGTGTGTTCGCTGCCCATTGGATGCAACTGTAAGG[T/A]AGGCATCCGAAAACCACTGGCGCCATCATAATTATTAAAAGCTTGAAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45598
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010496 | Nonsense | 79 | 280 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 17 (position 15452359)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 15603187 GRCz11 17 15611120 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCATGAAAATTGCTTCAAGTGTGCTAAGTGCAGCAGATCATTGGTGGAC[A/T]AACCGTTTGCTGCTAAAGATGAGCTTATGCTTTGCACCGAGTGTTACTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa337
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010496 | Nonsense | 123 | 280 | 4 | 6 |
ENSDART00000010496 | Nonsense | 123 | 280 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 17 (position 15450962)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 15601790 GRCz11 17 15609723 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTTTCCTCATTAGGATCACGGAAAATGGAGTACAAAGGGAACAGCTG[G/A]CATGAGACATGCTTTCTGTGTCAACGCTGTCAGCAGCCAATAGGAACCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa165
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010496 | Nonsense | 123 | 280 | 4 | 6 |
ENSDART00000010496 | Nonsense | 123 | 280 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 17 (position 15450962)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 15601790 GRCz11 17 15609723 - KASP Assay ID:
- 554-0061.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATWTTTTCCTCATTAGGATCACGGAAAATGGAGTACAAAGGGAACAGCTG[G/A]CATGAGACATGCTTTCTGTGTCAAMGCTGTCAGCAGCCAATAGGAACCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23027
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010496 | Essential Splice Site | 169 | 280 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 17 (position 15447575)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 15598403 GRCz11 17 15606336 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCCTTTAAGTCTATATTTACGGTACTGAGATCCACACTTTCACCTCTCC[A/T]GGCCATAACAACTGGCGGTGTCACATATCACGATAAGCCCTGGCACCGAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Coronary heart disease: A genome-wide association study for coronary artery disease identifies a novel susceptibility locus in the major histocompatibility complex. (View Study)
- Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: