zgc:92375

Ensembl ID:
ENSDARG00000014805
ZFIN ID:
ZDB-GENE-040822-3
Description:
hypothetical protein LOC445475 [Source:RefSeq peptide;Acc:NP_001004112]
Human Orthologue:
FHL5
Human Description:
four and a half LIM domains 5 [Source:HGNC Symbol;Acc:17371]
Mouse Orthologue:
Fhl5
Mouse Description:
four and a half LIM domains 5 Gene [Source:MGI Symbol;Acc:MGI:1913192]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32141 Essential Splice Site Available for shipment Available now
sa45598 Nonsense Mutation detected in F1 DNA During 2018
sa337 Nonsense Confirmed mutation in F2 line During 2018
sa165 Nonsense F2 line generated During 2018
sa23027 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010496 Essential Splice Site 53 280 2 6
Genomic Location (Zv9):
Chromosome 17 (position 15452550)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15603378
GRCz11 17 15611311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAACTGCTGCGAGGTGTGTTCGCTGCCCATTGGATGCAACTGTAAGG[T/A]AGGCATCCGAAAACCACTGGCGCCATCATAATTATTAAAAGCTTGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010496 Nonsense 79 280 3 6
Genomic Location (Zv9):
Chromosome 17 (position 15452359)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15603187
GRCz11 17 15611120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATGAAAATTGCTTCAAGTGTGCTAAGTGCAGCAGATCATTGGTGGAC[A/T]AACCGTTTGCTGCTAAAGATGAGCTTATGCTTTGCACCGAGTGTTACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa337
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010496 Nonsense 123 280 4 6
ENSDART00000010496 Nonsense 123 280 4 6
Genomic Location (Zv9):
Chromosome 17 (position 15450962)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15601790
GRCz11 17 15609723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTCCTCATTAGGATCACGGAAAATGGAGTACAAAGGGAACAGCTG[G/A]CATGAGACATGCTTTCTGTGTCAACGCTGTCAGCAGCCAATAGGAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa165
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010496 Nonsense 123 280 4 6
ENSDART00000010496 Nonsense 123 280 4 6
Genomic Location (Zv9):
Chromosome 17 (position 15450962)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15601790
GRCz11 17 15609723
KASP Assay ID:
554-0061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATWTTTTCCTCATTAGGATCACGGAAAATGGAGTACAAAGGGAACAGCTG[G/A]CATGAGACATGCTTTCTGTGTCAAMGCTGTCAGCAGCCAATAGGAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010496 Essential Splice Site 169 280 5 6
Genomic Location (Zv9):
Chromosome 17 (position 15447575)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15598403
GRCz11 17 15606336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTTAAGTCTATATTTACGGTACTGAGATCCACACTTTCACCTCTCC[A/T]GGCCATAACAACTGGCGGTGTCACATATCACGATAAGCCCTGGCACCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: A genome-wide association study for coronary artery disease identifies a novel susceptibility locus in the major histocompatibility complex. (View Study)
  • Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link