wnt11r

Ensembl ID:
ENSDARG00000014796
ZFIN ID:
ZDB-GENE-980526-249
Description:
protein Wnt-11 [Source:RefSeq peptide;Acc:NP_571151]
Human Orthologue:
WNT11
Human Description:
wingless-type MMTV integration site family, member 11 [Source:HGNC Symbol;Acc:12776]
Mouse Orthologue:
Wnt11
Mouse Description:
wingless-related MMTV integration site 11 Gene [Source:MGI Symbol;Acc:MGI:101948]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2545 Nonsense F2 line generated During 2018
sa27632 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2545
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099880 Nonsense 273 352 5 6
Genomic Location (Zv9):
Chromosome 10 (position 33071773)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32173122
GRCz11 10 32116982
KASP Assay ID:
554-2463.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCGAAAGACAWYGACATCCGGCCCGTGAGAGAGAATGAGCTGGTGTA[T/A]CTRCAGAGCTCRCCRGATTACTGCATGAAGAACGACAAGTTGGGCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099880 Essential Splice Site 295 352 5 6
Genomic Location (Zv9):
Chromosome 10 (position 33071840)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32173189
GRCz11 10 32117049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACTGCATGAAGAACGACAAGTTGGGCTCTTTCGGGACTCAGGACAGG[T/A]AAATCATAAATTATATACCTCTGTTTTTTCTCATTTTAAATTTGTTTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link