zgc:92453

Ensembl ID:
ENSDARG00000014794
ZFIN ID:
ZDB-GENE-040718-405
Description:
ubiquinol-cytochrome c reductase core protein II [Source:RefSeq peptide;Acc:NP_001002657]
Human Orthologue:
UQCRC2
Human Description:
ubiquinol-cytochrome c reductase core protein II [Source:HGNC Symbol;Acc:12586]
Mouse Orthologue:
Uqcrc2
Mouse Description:
ubiquinol cytochrome c reductase core protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914253]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40184 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17592 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010395 Essential Splice Site 96 459 4 14
Genomic Location (Zv9):
Chromosome 3 (position 59039774)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58101449
GRCz11 3 58171973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTTTAGATTAAATACTGGATGTGCTGTGAATAATGCCTGTGTGTTTC[A/T]GACCACTAAAGGTGCGTCAGCCTTCAAGATCTGTCGCAGTCTGGAGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010395 Nonsense 198 459 7 14
Genomic Location (Zv9):
Chromosome 3 (position 59042238)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58103913
GRCz11 3 58174437
KASP Assay ID:
2259-4215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTGCATGAAGCTGCTTATAAAAACGCYTTGTCCAACTCGCTCTACTG[T/A]CCAGACATCATGCTGGGGAAGATCAGTGTTGATCATGTAAGAGGCGAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link