
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-4c15.2
- Ensembl ID:
- ENSDARG00000014775
- ZFIN IDs:
- ZDB-GENE-050320-64, ZDB-GENE-050420-77
- Description:
- hypothetical protein LOC568943 [Source:RefSeq peptide;Acc:NP_001025399]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6687 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31065 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15555 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6687
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000106415 | Nonsense | 66 | 497 | 1 | 2 |
ENSDART00000141776 | Nonsense | 85 | 192 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 1659944)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 2401034 GRCz11 22 2417300 - KASP Assay ID:
- 554-4140.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGTTTCMGGCATAACCGCGATCTCGTTCGTCACACGATGATCCACACT[G/T]GAGAGAAACCKTACCAGTGTTCGCACTGCGACAAGAGATTCAATGATCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31065
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000106415 | Nonsense | 244 | 497 | 2 | 2 |
ENSDART00000141776 | None | 192 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 1662920)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 2404010 GRCz11 22 2420276 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAAAGCACATGAGAAGATCCACAGTGGCGTGAGAGAGTTTGCGTGCGAT[A/T]AGTGCGACAAGACTTTTCTAAGAGCTGGAAACTTGAAACGACACCAGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15555
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000106415 | Nonsense | 266 | 497 | 2 | 2 |
ENSDART00000141776 | None | 192 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 1662986)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 2404076 GRCz11 22 2420342 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCTAAGAGCTGGAAACTTGAARCGACACCAGARGACTCACGCTAAAGAT[A/T]AACCTGGTATTCAGTCGAGCAGCAGCMTGAGATTCGAGCAGCCACAAATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: