si:dkey-4c15.2

Ensembl ID:
ENSDARG00000014775
ZFIN IDs:
ZDB-GENE-050320-64, ZDB-GENE-050420-77
Description:
hypothetical protein LOC568943 [Source:RefSeq peptide;Acc:NP_001025399]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6687 Nonsense Mutation detected in F1 DNA During 2018
sa31065 Nonsense Mutation detected in F1 DNA During 2018
sa15555 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106415 Nonsense 66 497 1 2
ENSDART00000141776 Nonsense 85 192 3 4
Genomic Location (Zv9):
Chromosome 22 (position 1659944)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2401034
GRCz11 22 2417300
KASP Assay ID:
554-4140.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTTTCMGGCATAACCGCGATCTCGTTCGTCACACGATGATCCACACT[G/T]GAGAGAAACCKTACCAGTGTTCGCACTGCGACAAGAGATTCAATGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106415 Nonsense 244 497 2 2
ENSDART00000141776   None 192 None 4
Genomic Location (Zv9):
Chromosome 22 (position 1662920)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2404010
GRCz11 22 2420276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAGCACATGAGAAGATCCACAGTGGCGTGAGAGAGTTTGCGTGCGAT[A/T]AGTGCGACAAGACTTTTCTAAGAGCTGGAAACTTGAAACGACACCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106415 Nonsense 266 497 2 2
ENSDART00000141776   None 192 None 4
Genomic Location (Zv9):
Chromosome 22 (position 1662986)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2404076
GRCz11 22 2420342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTAAGAGCTGGAAACTTGAARCGACACCAGARGACTCACGCTAAAGAT[A/T]AACCTGGTATTCAGTCGAGCAGCAGCMTGAGATTCGAGCAGCCACAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link