arf2

Ensembl ID:
ENSDARG00000014763
ZFIN ID:
ZDB-GENE-040122-4
Description:
ADP-ribosylation factor 2 [Source:RefSeq peptide;Acc:NP_958912]
Human Orthologues:
ARF1, ARF3
Human Descriptions:
ADP-ribosylation factor 1 [Source:HGNC Symbol;Acc:652]
ADP-ribosylation factor 3 [Source:HGNC Symbol;Acc:654]
Mouse Orthologues:
Arf1, Arf2, Arf3
Mouse Descriptions:
ADP-ribosylation factor 1 Gene [Source:MGI Symbol;Acc:MGI:99431]
ADP-ribosylation factor 2 Gene [Source:MGI Symbol;Acc:MGI:99595]
ADP-ribosylation factor 3 Gene [Source:MGI Symbol;Acc:MGI:99432]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45146 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016407 Nonsense 159 181 5 5
Genomic Location (Zv9):
Chromosome 3 (position 37555326)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37418686
GRCz11 3 37560544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGCCTTCATTCCCTGCGTCATCGTAACTGGTACATCCAGGCCACCTG[C/A]GCCACTAGCGGTGATGGCCTTTATGAAGGGCTTGACTGGCTCTCTAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link