
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rbfox1
- Ensembl ID:
- ENSDARG00000014746
- ZFIN ID:
- ZDB-GENE-040927-11
- Description:
- Fox-1 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q642J5]
- Human Orthologue:
- RBFOX1
- Human Description:
- RNA binding protein, fox-1 homolog (C. elegans) 1 [Source:HGNC Symbol;Acc:18222]
- Mouse Orthologue:
- Rbfox1
- Mouse Description:
- RNA binding protein, fox-1 homolog (C. elegans) 1 Gene [Source:MGI Symbol;Acc:MGI:1926224]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15940 | Essential Splice Site | Available for shipment | Available now |
sa26072 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15281 | Essential Splice Site | Available for shipment | Available now |
sa38393 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15940
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122037 | Essential Splice Site | 12 | 373 | 2 | 12 |
The following transcripts of ENSDARG00000014746 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 28219448)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 27937487 GRCz11 3 28068329 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAAACTAYCCAGGCAGTCATTTGACCATTTTTGAAATGTTGTTTTTTTNC[A/T]GGGTAAWCAAGACGCCCCAGCACCCCCAGAAACCATGGCCCAGCCTTTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26072
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122037 | Nonsense | 149 | 373 | 4 | 12 |
The following transcripts of ENSDARG00000014746 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 28196826)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 27914865 GRCz11 3 28045707 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATCTGTCTTCTGTTCTCTTTCCAGCAATTTGGTAAAATCTTAGATGTT[G/T]AAATCATATTTAATGAACGAGGATCAAAGGTACGTTTTGTGACTTTTATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15281
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122037 | Essential Splice Site | 210 | 373 | 6 | 12 |
The following transcripts of ENSDARG00000014746 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 28193032)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 27911071 GRCz11 3 28041913 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAGCACGGGTAATGACGAATAAAAAGACAGTCAACCCATATGCAAATGG[T/A]AAGAACAAGCTCCCTTGATGTTGTCGAATGCATAMGAGTATAGATTGAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38393
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122037 | Nonsense | 211 | 373 | 7 | 12 |
The following transcripts of ENSDARG00000014746 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 28190703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 27908742 GRCz11 3 28039584 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTAGTTTGCTAATATCAGATCTCTTGCTCTCTGTGTTTGTCTAGGCTG[G/A]AAGTTGAATCCAGTCGTGGGTGCAGTCTACAGCCCAGAATTCTATGCAGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
- Refractive error: Meta-analysis of genome-wide association studies in five cohorts reveals common variants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: