DYNC1H1
- Ensembl ID:
- ENSDARG00000014717
- Description:
- dynein, cytoplasmic 1, heavy chain 1 [Source:HGNC Symbol;Acc:2961]
- Human Orthologue:
- DYNC1H1
- Human Description:
- dynein, cytoplasmic 1, heavy chain 1 [Source:HGNC Symbol;Acc:2961]
- Mouse Orthologue:
- Dync1h1
- Mouse Description:
- dynein cytoplasmic 1 heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:103147]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa19157 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa9468 |
Essential Splice Site |
Available for shipment |
Available now |
sa30693 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42841 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa42840 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44865 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa42839 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa45588 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa19157
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Essential Splice Site |
1993 |
4548 |
39 |
98 |
ENSDART00000034216 |
Essential Splice Site |
1993 |
4548 |
39 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 214358)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1568748 |
GRCz11 |
17 |
913198 |
- KASP Assay ID:
- 2261-0451.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCCTTGCGTGTTGTTGACGTGTTAATGATTGCACGTGTGTGTTGTGCA[G/T]GTGTGCCCGTCACCACCGAGCTGCTGAATAAGCAGGTGAAGGTGAGTGCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9468
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Essential Splice Site |
1993 |
4548 |
39 |
98 |
ENSDART00000034216 |
Essential Splice Site |
1993 |
4548 |
39 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 214358)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1568748 |
GRCz11 |
17 |
913198 |
- KASP Assay ID:
- 2261-0451.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TKTCCTTGCGTGTTGTTGACGTGTTAATGATTGCACRTGTGTGTTGTKCA[G/T]GTGTGCCCGTCACCACYGAGCTGCTGAATAAGCAGGTGAAGGTGAGTGCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30693
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Nonsense |
2545 |
4548 |
48 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 205213)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1559603 |
GRCz11 |
17 |
904053 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGCGTGTGTGTGTGTGTGTCCTGTGCAGGTGTCCATCACGGGCGAGTGG[C/T]AGTCCTGGCAGGGGAAGGTGCCCCAGATCGAGGTGGAGACCCATAAGGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42841
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Essential Splice Site |
2780 |
4548 |
51 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 203464)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1557854 |
GRCz11 |
17 |
902304 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCCGAGCCGCTCACCGCCGCCATGGTGGAGTTCTACACCATGTCTCAGG[T/C]GCGCAGACACAGAGCTGAACACAGAGTCTGCTATGAGCACAGCACAGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42840
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Essential Splice Site |
2888 |
4548 |
54 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 202353)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1556743 |
GRCz11 |
17 |
901193 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCGGTAATGATGAGACGTCTGTAATGATCAAGCGGTAATGACAAGACT[G/A]TAGGGTCGAAACTGAAGTGACGATAACTCATTAACAACTAGATAAGGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44865
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Essential Splice Site |
2897 |
4548 |
54 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 202325)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1556715 |
GRCz11 |
17 |
901165 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAAGCGGTAATGACAAGACTGTAGGGTCGAAACTGAAGTGACGATAAC[T/C]CATTAACAACTAGATAAGGTTTTAATAAGGCGTTAATGGTGCAATTGGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42839
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Essential Splice Site |
2920 |
4548 |
56 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 202213)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1556603 |
GRCz11 |
17 |
901053 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACAACAAGATGTTATCATCATCTGGTTATTAACATGTCAGTGTTTGTC[G/T]TCTCATTTTTGCCATCTCATTATCATCTGGTTATAAACAAGTCGTTAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45588
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000034216 |
Nonsense |
3492 |
4548 |
77 |
98 |
- Genomic Location (Zv9):
- Chromosome 17 (position 188009)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
1542399 |
GRCz11 |
17 |
886849 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGGGAGAAGACCAGCGAGACCTTCAAGAACCAGATGTCCACCATCGCC[G/T]GAGACTGCCTGCTGTCCGCCGCCTTCATCGCCTACGCCGGCTACTTCGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: