pgm2l1

Ensembl ID:
ENSDARG00000014704
ZFIN IDs:
ZDB-GENE-041008-205, ZDB-GENE-041008-205
Description:
glucose 1,6-bisphosphate synthase [Source:RefSeq peptide;Acc:NP_001091955]
Human Orthologue:
PGM2L1
Human Description:
phosphoglucomutase 2-like 1 [Source:HGNC Symbol;Acc:20898]
Mouse Orthologue:
Pgm2l1
Mouse Description:
phosphoglucomutase 2-like 1 Gene [Source:MGI Symbol;Acc:MGI:1918224]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15433 Essential Splice Site Available for shipment Available now
sa44816 Nonsense Mutation detected in F1 DNA During 2018
sa39029 Nonsense Mutation detected in F1 DNA During 2018
sa39030 Nonsense Mutation detected in F1 DNA During 2018
sa24973 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35800 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010350 Essential Splice Site 72 509 3 12
ENSDART00000101937 Essential Splice Site 182 619 5 14
Genomic Location (Zv9):
Chromosome 15 (position 4992274)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5142327
GRCz11 15 5133474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATGATCACTGCTTCTCATAACAGAAAAGARGACAATGGATAYAAGG[T/C]GAGCTGWCTGCTGYATTACAGTTAGAAAATAACWTTGCCTAAAAACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010350 Nonsense 159 509 5 12
ENSDART00000101937 Nonsense 269 619 7 14
Genomic Location (Zv9):
Chromosome 15 (position 4998929)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5148982
GRCz11 15 5140129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCTCTGAAGTTTGTCCATTCATCATTCCATGGTGTGGGTCACAACTA[T/A]GTCCAGAGGGCTTTTCAGCAGTTTGGTTTCCCGCCGCCAATTCCTGTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010350 Nonsense 198 509 5 12
ENSDART00000101937 Nonsense 308 619 7 14
Genomic Location (Zv9):
Chromosome 15 (position 4999045)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5149098
GRCz11 15 5140245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCCAGATTTTTCCACAGTCAGCTGTCCTAACCCAGAGGAAGGAGAGT[C/A]AGTCTTAGTAAGATTTGTTTTCTTAGTTAAATAATACCAAATATATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010350 Nonsense 366 509 9 12
ENSDART00000101937 Nonsense 476 619 11 14
Genomic Location (Zv9):
Chromosome 15 (position 5001357)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5151410
GRCz11 15 5142557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTACACACCAAAAACCTTTCCTTGAACCAACAACTATGTAACATCTA[C/A]GAAATGTGAGTATCTCTTGTTTGTTATAAGGTCAGTTCATACCCATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010350 Essential Splice Site 368 509 9 12
ENSDART00000101937 Essential Splice Site 478 619 11 14
Genomic Location (Zv9):
Chromosome 15 (position 5001363)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5151416
GRCz11 15 5142563
KASP Assay ID:
554-7366.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACCAAAAACCTTTCCTTGAACCAACAACTATGTAACATCTACGAAAT[G/A]TGAGTATCTCTTGTTTGTTATAAGGTCAGTTCATACCCATAGACAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010350 Nonsense 375 509 10 12
ENSDART00000101937 Nonsense 485 619 12 14
Genomic Location (Zv9):
Chromosome 15 (position 5003576)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5153629
GRCz11 15 5144776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGTGTATGTTTGATCTGTTTATTGTAGATACGGGTATCACATTTCT[C/T]GAACGTCCTATGTCCTCTGCAATGACCCACCCACTATTCATAGAATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link