zgc:172258

Ensembl ID:
ENSDARG00000014682
ZFIN ID:
ZDB-GENE-080204-66
Description:
transmembrane protein 26 [Source:RefSeq peptide;Acc:NP_001108064]
Human Orthologue:
TMEM26
Human Description:
transmembrane protein 26 [Source:HGNC Symbol;Acc:28550]
Mouse Orthologue:
Tmem26
Mouse Description:
transmembrane protein 26 Gene [Source:MGI Symbol;Acc:MGI:2143537]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22033 Nonsense Available for shipment Available now
sa18132 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020995 Nonsense 143 303 4 6
Genomic Location (Zv9):
Chromosome 12 (position 8730169)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8033767
GRCz11 12 8067750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAATTACTGTCAACGGTTTGTGCCAATGACTGGATCCTGGCTCTTCAA[C/T]AAATCGTTCTGATTCTGCTAATAGTGGGAAAATGGATGCTACCGATCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020995 Essential Splice Site 220 303 6 6
Genomic Location (Zv9):
Chromosome 12 (position 8726931)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8030529
GRCz11 12 8064512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYAAAGTATAATCATAAGTGTTATAATGCTGTATTTGTTCATTTGCATT[A/G]GTGGTGAACACCAGAGCAGAAGATGTTTCTGWAAGCCAGGATGGCTCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link