zgc:66441

Ensembl ID:
ENSDARG00000014680
ZFIN ID:
ZDB-GENE-030131-5559
Description:
zinc finger protein 710 [Source:RefSeq peptide;Acc:NP_956086]
Human Orthologue:
ZNF710
Human Description:
zinc finger protein 710 [Source:HGNC Symbol;Acc:25352]
Mouse Orthologue:
Zfp710
Mouse Description:
zinc finger protein 710 Gene [Source:MGI Symbol;Acc:MGI:1921747]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43117 Nonsense Mutation detected in F1 DNA During 2018
sa43118 Nonsense Mutation detected in F1 DNA During 2018
sa43119 Nonsense Mutation detected in F1 DNA During 2018
sa16083 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015712 Nonsense 259 700 2 5
Genomic Location (Zv9):
Chromosome 18 (position 25875304)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26104987
GRCz11 18 26089507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGAAAACCACAGACGAGGATGTGAACCCAGCTATAAGGCGGTACTA[T/G]GAATCCAGCATGACAGCATATGAAGCTGCTGAGATTGGTCTGCCGGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015712 Nonsense 277 700 2 5
Genomic Location (Zv9):
Chromosome 18 (position 25875358)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26105041
GRCz11 18 26089561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCATGACAGCATATGAAGCTGCTGAGATTGGTCTGCCGGGAGATTA[T/A]GAAGAGGGTGGCCAGCCCATGGTTTGGGCTGAGAGTGAAAACTCCCTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015712 Nonsense 495 700 2 5
Genomic Location (Zv9):
Chromosome 18 (position 25876010)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26105693
GRCz11 18 26090213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAACCATCTGATGAAGCACCAGAATGTGCGGCCCTATGTCTGCTCA[G/T]AGTGCGGCATGGAGTTTGTGCAGATCCACCACCTGAAGCAGCACATGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015712 Nonsense 508 700 2 5
Genomic Location (Zv9):
Chromosome 18 (position 25876049)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26105732
GRCz11 18 26090252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTGCTCAGAGTGCGGCATGGAGTTTGTGCAGATCCACCACCTGAAG[C/T]AGCACATGCTTACACACAAGGTACTGACACAGCAGGCCCCCGAACACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link