
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ANKRD13B
- Ensembl ID:
- ENSDARG00000014652
- Description:
- ankyrin repeat domain 13B [Source:HGNC Symbol;Acc:26363]
- Human Orthologue:
- ANKRD13B
- Human Description:
- ankyrin repeat domain 13B [Source:HGNC Symbol;Acc:26363]
- Mouse Orthologue:
- Ankrd13b
- Mouse Description:
- ankyrin repeat domain 13b Gene [Source:MGI Symbol;Acc:MGI:2144501]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa28469 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa14927 | Nonsense | Available for shipment | Available now |
sa22662 | Nonsense | Available for shipment | Available now |
sa10858 | Essential Splice Site | Available for shipment | Available now |
sa35904 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa28469
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015286 | Essential Splice Site | 36 | 632 | 1 | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 27832230)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 28550470 GRCz11 15 28483346 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAATAACAAACACCGGCAGCTGGAGAAAGAGCTCTCAGTGCGTGAGCAG[G/A]TAAGATGCGTTGGTTTCCGCGTGCCAGTCTCGCAGCAGATGATGCTCGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14927
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015286 | Nonsense | 42 | 632 | 2 | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 27858699)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 28576939 GRCz11 15 28509815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGTCAATAAAATGAAYCTCTCTCTGTCTTAAAGGTCGATTTGGAAGTGT[T/A]GGACCCACGGGGCCGGACTCCTTTRCACCTTGCAGTGACGCTGGGTCATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22662
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015286 | Nonsense | 110 | 632 | 3 | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 27860974)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 28579214 GRCz11 15 28512090 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTGGTACGGCTGGCGCTGCGTTACCGTGACTACCAGCGTACCACTAAA[C/T]GACTGGCAGGGATCCCGCGTCTGCTGGAGAGACTCCGACAGGTCAGCCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10858
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015286 | Essential Splice Site | 138 | 632 | 4 | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 27861488)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 28579728 GRCz11 15 28512604 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGGCACAGGATTTTTACGTGGAGATGAAATGGGAGTTTACCAGTTGGG[G/A]TAGGTCTTATCTCTAGTAATGTGGYGTAAATGGTATGCTTAAAAAGCRCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35904
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015286 | Nonsense | 592 | 632 | 15 | 15 |
- Genomic Location (Zv9):
- Chromosome 15 (position 27886718)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 28604958 GRCz11 15 28537834 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCGTGGAGAGCCCTCGCAGCACACCTACCAATAAACCACCGTGCAGCTA[C/A]GACGAGCAGCTCCGTCTTGCCATGGCCCTGTCTGCCCGAGAGCAGGAAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: