si:dkey-42d18.3
- Ensembl ID:
- ENSDARG00000014651
- ZFIN ID:
- ZDB-GENE-081104-411
- Description:
- Novel protein similar to vertebrate supervillin (SVIL) [Source:UniProtKB/TrEMBL;Acc:B8JKW2]
- Human Orthologue:
- SVIL
- Human Description:
- supervillin [Source:HGNC Symbol;Acc:11480]
- Mouse Orthologue:
- Svil
- Mouse Description:
- supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]
Alleles
There are 14 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa10598 |
Nonsense |
Available for shipment |
Available now |
sa14792 |
Nonsense |
Available for shipment |
Available now |
sa19885 |
Essential Splice Site |
Available for shipment |
Available now |
sa6021 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa19884 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa14317 |
Essential Splice Site |
Available for shipment |
Available now |
sa13615 |
Essential Splice Site |
Available for shipment |
Available now |
sa11474 |
Nonsense |
Available for shipment |
Available now |
sa39938 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa25123 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa39937 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa33029 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa25122 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa33028 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa10598
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49386475)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49089881 |
GRCz11 |
2 |
48824111 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATAAGTGTTAATTCCTCTCTTTCCTCCATTAATGAAGAATAAGAGTTAGA[G/T]AGAGACAGACAAGGGAGGACATATCAGGAAGAGRTTCTGATTCAGGACCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14792
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49386259)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49089665 |
GRCz11 |
2 |
48823895 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- STCAAGGWATGGATGCCCGTCAACAAAGGGCGCATAGTGCAGAGCGGCCA[C/T]GATTCCAGCGCACTCACAGTATGGATTCACCTGCCTTTCAACACACACCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19885
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 49385291)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49088697 |
GRCz11 |
2 |
48822927 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTGTTGGAACTGGAATTACTCGGATGGAGGAAGGTGGAATGATATCAGG[T/C]GAAATGGTAATTGGTATTCTAAAAGACAGAGGATGTGATGATCGAAGAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6021
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49385065)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49088471 |
GRCz11 |
2 |
48822701 |
- KASP Assay ID:
- 554-3966.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGGATGAGGAGAGCTCTGATTGGAATACTAACCGGTTAGGAGAGATAGAA[C/T]AAGGAAGTGCGAAGAAGGTTAATGAATTCAAAGAAAGAGAATGGGAAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19884
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49384316)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49087722 |
GRCz11 |
2 |
48821952 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGAGACATTCCTACCTGGAGAATGCTTCTGGACGCAGACCTGAGCTGTA[T/A]GTGGACTGGCATGCCGGCATGCTAAAGCAAGCTTCTGTCATTGACTATTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14317
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 49364885)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49067881 |
GRCz11 |
2 |
48802021 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAACACCCGCTTTCAGACCCAGCCAATCACTCAGGACGAGGTYGATCAGG[T/C]AGGGCCTCCCTCTTTTTYTCCATCTGAACAAGTTCACAAATATGGAGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13615
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 49357967)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49060963 |
GRCz11 |
2 |
48795103 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATCGCCACACAGCAAGGGCGGGGCTGCATCAATTCCAGCCAATAAWGAAA[G/A]TGGGCAGAGGGGAAGAGCGGGGTATTTAGGCAGAGAGGAGAGAGAGGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11474
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49352917)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49055913 |
GRCz11 |
2 |
48790053 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAATCTACACCCGGCCTCAAACGCAACCTTACAGCCCACCGACACCATCA[C/T]AAACWCTCCACCCGGACRTCCATCCAGMGTATCACGATCTTCAACGGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39938
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49352773)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49055769 |
GRCz11 |
2 |
48789909 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCGCCTCAATCACACGCATACATTTCTCCTCCGCCCAAAATACCTCCT[C/T]AAACCCAGCCCAAACCCCAGTGCTTCATCCCGCCTCAGCCTCAAGAGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25123
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49340026)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49043022 |
GRCz11 |
2 |
48777162 |
- KASP Assay ID:
- 554-7487.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGAGTGTGATCTATAACTGTAAAATCTGTGTTTGCATGATCAGAAACTT[G/T]AAGAGGGTGAGGGTCAGATGTCCATTGAAGAGAGGAAGCAGATGATCTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39937
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 49337353)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49040349 |
GRCz11 |
2 |
48774489 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGCAATGTTGTTGCACCATGATAACTGGGGCAAAACCTGATGTGCTGCA[G/T]AAATCGAGGCCAGGGCAGAAATGGAGTCTGATAAAAAGCTGGAAAAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33029
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49331423)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49034419 |
GRCz11 |
2 |
48768559 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGCTTCAGAACTGGCCACTTTTATCCAGCTGAACCATGATCTGGGTTG[T/A]CGAGCTGCGTTTGTGGAGACCATTGAAGAAGGAGTAAACGCACAAAGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25122
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 49326172)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49029168 |
GRCz11 |
2 |
48763308 |
- KASP Assay ID:
- 554-7816.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGGAGACGCGTATGTGCTCAAGTGGAAGTACATGGTGAGCGCAGCAGG[T/G]CAGTATCTGCACCGGGACACATGAGCTATTTATTCGGAAACTTGAATTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33028
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 49322410)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
49025406 |
GRCz11 |
2 |
48759546 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTCAACATCAACAAAGCACTCATCTACCTGTGGCACGGCTGCAAAACA[C/T]AGACTCACTCACGGCATGTGGCTCGAACGGCAGCGGACAAAATCAAAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: