si:dkey-42d18.3

Ensembl ID:
ENSDARG00000014651
ZFIN ID:
ZDB-GENE-081104-411
Description:
Novel protein similar to vertebrate supervillin (SVIL) [Source:UniProtKB/TrEMBL;Acc:B8JKW2]
Human Orthologue:
SVIL
Human Description:
supervillin [Source:HGNC Symbol;Acc:11480]
Mouse Orthologue:
Svil
Mouse Description:
supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10598 Nonsense Available for shipment Available now
sa14792 Nonsense Available for shipment Available now
sa19885 Essential Splice Site Available for shipment Available now
sa6021 Nonsense Mutation detected in F1 DNA During 2018
sa19884 Nonsense Mutation detected in F1 DNA During 2018
sa14317 Essential Splice Site Available for shipment Available now
sa13615 Essential Splice Site Available for shipment Available now
sa11474 Nonsense Available for shipment Available now
sa39938 Nonsense Mutation detected in F1 DNA During 2018
sa25123 Nonsense Mutation detected in F1 DNA During 2018
sa39937 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33029 Nonsense Mutation detected in F1 DNA During 2018
sa25122 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33028 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 300 2195 6 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49386475)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49089881
GRCz11 2 48824111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAGTGTTAATTCCTCTCTTTCCTCCATTAATGAAGAATAAGAGTTAGA[G/T]AGAGACAGACAAGGGAGGACATATCAGGAAGAGRTTCTGATTCAGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 372 2195 6 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49386259)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49089665
GRCz11 2 48823895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
STCAAGGWATGGATGCCCGTCAACAAAGGGCGCATAGTGCAGAGCGGCCA[C/T]GATTCCAGCGCACTCACAGTATGGATTCACCTGCCTTTCAACACACACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 460 2195 8 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49385291)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49088697
GRCz11 2 48822927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTTGGAACTGGAATTACTCGGATGGAGGAAGGTGGAATGATATCAGG[T/C]GAAATGGTAATTGGTATTCTAAAAGACAGAGGATGTGATGATCGAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 464 2195 9 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49385065)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49088471
GRCz11 2 48822701
KASP Assay ID:
554-3966.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATGAGGAGAGCTCTGATTGGAATACTAACCGGTTAGGAGAGATAGAA[C/T]AAGGAAGTGCGAAGAAGGTTAATGAATTCAAAGAAAGAGAATGGGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 591 2195 10 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49384316)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49087722
GRCz11 2 48821952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGACATTCCTACCTGGAGAATGCTTCTGGACGCAGACCTGAGCTGTA[T/A]GTGGACTGGCATGCCGGCATGCTAAAGCAAGCTTCTGTCATTGACTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 836 2195 17 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49364885)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49067881
GRCz11 2 48802021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACCCGCTTTCAGACCCAGCCAATCACTCAGGACGAGGTYGATCAGG[T/C]AGGGCCTCCCTCTTTTTYTCCATCTGAACAAGTTCACAAATATGGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 926 2195 18 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49357967)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49060963
GRCz11 2 48795103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCCACACAGCAAGGGCGGGGCTGCATCAATTCCAGCCAATAAWGAAA[G/A]TGGGCAGAGGGGAAGAGCGGGGTATTTAGGCAGAGAGGAGAGAGAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1000 2195 22 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49352917)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49055913
GRCz11 2 48790053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTACACCCGGCCTCAAACGCAACCTTACAGCCCACCGACACCATCA[C/T]AAACWCTCCACCCGGACRTCCATCCAGMGTATCACGATCTTCAACGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1048 2195 22 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49352773)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49055769
GRCz11 2 48789909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGCCTCAATCACACGCATACATTTCTCCTCCGCCCAAAATACCTCCT[C/T]AAACCCAGCCCAAACCCCAGTGCTTCATCCCGCCTCAGCCTCAAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1147 2195 26 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49340026)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49043022
GRCz11 2 48777162
KASP Assay ID:
554-7487.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGTGTGATCTATAACTGTAAAATCTGTGTTTGCATGATCAGAAACTT[G/T]AAGAGGGTGAGGGTCAGATGTCCATTGAAGAGAGGAAGCAGATGATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 1225 2195 28 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49337353)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49040349
GRCz11 2 48774489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAATGTTGTTGCACCATGATAACTGGGGCAAAACCTGATGTGCTGCA[G/T]AAATCGAGGCCAGGGCAGAAATGGAGTCTGATAAAAAGCTGGAAAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1483 2195 33 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49331423)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49034419
GRCz11 2 48768559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTTCAGAACTGGCCACTTTTATCCAGCTGAACCATGATCTGGGTTG[T/A]CGAGCTGCGTTTGTGGAGACCATTGAAGAAGGAGTAAACGCACAAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Essential Splice Site 1774 2195 39 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49326172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49029168
GRCz11 2 48763308
KASP Assay ID:
554-7816.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGAGACGCGTATGTGCTCAAGTGGAAGTACATGGTGAGCGCAGCAGG[T/G]CAGTATCTGCACCGGGACACATGAGCTATTTATTCGGAAACTTGAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111670 Nonsense 1912 2195 42 48
ENSDART00000134711   None 179 None 6
Genomic Location (Zv9):
Chromosome 2 (position 49322410)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49025406
GRCz11 2 48759546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCAACATCAACAAAGCACTCATCTACCTGTGGCACGGCTGCAAAACA[C/T]AGACTCACTCACGGCATGTGGCTCGAACGGCAGCGGACAAAATCAAAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link