zgc:113006

Ensembl ID:
ENSDARG00000014646
ZFIN ID:
ZDB-GENE-050320-133
Description:
amine oxidase, copper containing 3 [Source:RefSeq peptide;Acc:NP_001013573]
Human Orthologues:
AOC2, AOC3
Human Descriptions:
amine oxidase, copper containing 2 (retina-specific) [Source:HGNC Symbol;Acc:549]
amine oxidase, copper containing 3 (vascular adhesion protein 1) [Source:HGNC Symbol;Acc:550]
Mouse Orthologues:
Aoc2, Aoc3
Mouse Descriptions:
amine oxidase, copper containing 2 (retina-specific) Gene [Source:MGI Symbol;Acc:MGI:2668431]
amine oxidase, copper containing 3 Gene [Source:MGI Symbol;Acc:MGI:1306797]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6037 Nonsense Mutation detected in F1 DNA During 2018
sa40100 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027258 Nonsense 459 754 1 4
ENSDART00000124160   None 223 None 4
ENSDART00000140117 Nonsense 451 746 1 4

The following transcripts of ENSDARG00000014646 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 33063142)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32794452
GRCz11 3 32926166
KASP Assay ID:
554-3783.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRGCGAACAGCGCCCTGGTGATCCGCTCCATTACTGCTATAGGGAACTA[T/G]GACTACATATGGGACTTYATTTTCTATCAGAGTGRCTCAGTGGAGGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027258 Nonsense 723 754 4 4
ENSDART00000124160 Nonsense 192 223 4 4
ENSDART00000140117 Nonsense 715 746 4 4

The following transcripts of ENSDARG00000014646 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 33061685)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32792995
GRCz11 3 32924709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACTCACCTGATGGTGTGCATTTTATTCCGGGCTCTGAAAATGACTGT[G/T]AGTACAACAAAATGGCGTGTCTGGAAAAGGATCAGTGCACTTCCACACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link