wu:fj40e01

Ensembl ID:
ENSDARG00000014624
ZFIN ID:
ZDB-GENE-030131-7910
Description:
hypothetical protein LOC797092 [Source:RefSeq peptide;Acc:NP_001093528]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25917 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008267 Nonsense 67 290 1 4
ENSDART00000056255 Nonsense 89 298 2 5
ENSDART00000123448 Nonsense 91 338 2 5
Genomic Location (Zv9):
Chromosome 2 (position 48941084)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48698624
GRCz11 2 48552788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGATTGGACTGAAGAGAGGGACACAGAAACGTTGGGGCTGGTCTTAT[G/T]GAGATAACACAATCGCACAGTACGCTGCTTGGAGCAATGGAGAACCGTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link