zgc:114067

Ensembl ID:
ENSDARG00000014599
ZFIN ID:
ZDB-GENE-050913-86
Description:
hypothetical protein LOC796312 [Source:RefSeq peptide;Acc:NP_001020699]
Human Orthologue:
SLC5A6
Human Description:
solute carrier family 5 (sodium-dependent vitamin transporter), member 6 [Source:HGNC Symbol;Acc:110
Mouse Orthologue:
Slc5a6
Mouse Description:
solute carrier family 5 (sodium-dependent vitamin transporter), member 6 Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32117 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062952 Nonsense 545 602 15 16
ENSDART00000121789 Nonsense 545 603 15 16
Genomic Location (Zv9):
Chromosome 17 (position 6319299)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6398235
GRCz11 17 6555465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCAAGGCCCAACAAAAGGAGACGATGTGGCCTCGGGCACAGTATA[T/A]CCTGTGGTGAAAACAGCTCAGTCTTATCTGAAGCCCAGCACTTGCTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link