si:dkey-261o10.2

Ensembl ID:
ENSDARG00000014592
ZFIN IDs:
ZDB-GENE-060404-6, ZDB-GENE-091118-31
Human Orthologue:
DENND1A
Human Description:
DENN/MADD domain containing 1A [Source:HGNC Symbol;Acc:29324]
Mouse Orthologue:
Dennd1a
Mouse Description:
DENN/MADD domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2442794]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37235 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16575 Essential Splice Site Available for shipment Available now
sa14051 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055336 Essential Splice Site 42 1007 3 25
ENSDART00000143151 Essential Splice Site 42 511 3 20
Genomic Location (Zv9):
Chromosome 21 (position 7938694)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8346245
GRCz11 21 8438784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGACTAGAGGTGCGCAGAAGTTTCCCCGACACATACACTGAACAGG[T/G]TTGTGCTTCTTAATTTTTTTTCCTCTGTGTTTCTCCAGGGATGTTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055336 Essential Splice Site 488 1007 19 25
ENSDART00000143151 Essential Splice Site 488 511 19 20
Genomic Location (Zv9):
Chromosome 21 (position 7956056)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8363607
GRCz11 21 8456146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCCTCACCTGGGACCAGAGGCGGCCAATCACAGTTCACTTTGGGCAG[G/A]TGGGTAAAAGAGATGTTGTGAATTCTTGTTAGATTRAAAAAGYGTATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055336 Nonsense 833 1007 24 25
ENSDART00000143151   None 511 None 20
Genomic Location (Zv9):
Chromosome 21 (position 7969790)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8377341
GRCz11 21 8469880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGACCAATGAGCCAAAYGAGGGACAGGAGCAGGACTTACTTAGCTTGT[T/A]GGATCCGTTGTGTGGAGCAACAAAGGATGAGGCCACMYCATCCCTTTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Personality dimensions: A genome-wide association study of Cloninger's temperament scales: implications for the evolutionary genetics of personality. (View Study)
  • Polycystic ovary syndrome: Genome-wide association study identifies susceptibility loci for polycystic ovary syndrome on chromosome 2p16.3, 2p21 and 9q33.3. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link