
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rhpn2
- Ensembl ID:
- ENSDARG00000014577
- ZFIN ID:
- ZDB-GENE-030131-9927
- Description:
- Rhophilin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q6TNR1]
- Human Orthologues:
- AC126603.1, RHPN2
- Human Descriptions:
- Putative rhophilin-2-like protein [Source:UniProtKB/Swiss-Prot;Acc:A8MT19]
- rhophilin, Rho GTPase binding protein 2 [Source:HGNC Symbol;Acc:19974]
- Mouse Orthologue:
- Rhpn2
- Mouse Description:
- rhophilin, Rho GTPase binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1289234]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21021 | Nonsense | Available for shipment | Available now |
sa1319 | Essential Splice Site | Available for shipment | Available now |
sa10688 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21021
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010046 | Nonsense | 137 | 683 | 5 | 15 |
The following transcripts of ENSDARG00000014577 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 39764926)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 38101566 GRCz11 7 38372824 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATGGGTACAAAAATGATTTATTTGAACAGGACTTCATCCTGGAACACTA[C/A]AGTGAAGATGGCTCAAACTTCCAGAATCAGATCGATGACCTCATGGACCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1319
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010046 | Essential Splice Site | 473 | 683 | 11 | 15 |
The following transcripts of ENSDARG00000014577 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 39774234)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 38110874 GRCz11 7 38382132 - KASP Assay ID:
- 554-1233.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGACAAGGAAGACGAGTTCACAGACTACATGCTTGCACCAGATATTATCT[G/A]TAAGTCAGAGATGGACACTATTGGAACCRCCRTTTTATTAGAACAGAATC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa10688
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010046 | Nonsense | 531 | 683 | 13 | 15 |
The following transcripts of ENSDARG00000014577 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 39777607)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 38114247 GRCz11 7 38385505 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CRCGCACCATCAGGCTCATACTGCAGGACAGAGACCTCGGGTTTACRCTC[A/T]AGGGAGATGCACCCGTTCAGATACAGTCRCTCGACCCCCTTTGTCCCGCW
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Colorectal cancer: Meta-analysis of genome-wide association data identifies four new susceptibility loci for colorectal cancer. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: