wnt5a

Ensembl ID:
ENSDARG00000014495
ZFIN IDs:
ZDB-GENE-060328-3, ZDB-GENE-060328-3
Description:
protein Wnt-5a [Source:RefSeq peptide;Acc:NP_001073303]
Human Orthologues:
WNT5A, WNT5B
Human Descriptions:
wingless-type MMTV integration site family, member 5A [Source:HGNC Symbol;Acc:12784]
wingless-type MMTV integration site family, member 5B [Source:HGNC Symbol;Acc:16265]
Mouse Orthologues:
Wnt5a, Wnt5b
Mouse Descriptions:
wingless-related MMTV integration site 5A Gene [Source:MGI Symbol;Acc:MGI:98958]
wingless-related MMTV integration site 5B Gene [Source:MGI Symbol;Acc:MGI:98959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa93 Missense Confirmed mutation in F2 line During 2018
sa44695 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa93
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023675 Missense 109 374 3 6
ENSDART00000123877 Missense 109 374 3 5
Genomic Location (Zv9):
Chromosome 8 (position 55922264)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53845428
GRCz11 8 53675158
KASP Assay ID:
554-0068.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGGGCATCAGGGAGTGCCAGCACCAGTTCCGCCACCACCGCTGGAAC[T/A]GCAGCACCGTCGACAACTCCACAGTGCTGGGCAGAGTCATGCACATCGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa44695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023675 Nonsense 196 374 4 6
ENSDART00000123877 Nonsense 196 374 4 5
Genomic Location (Zv9):
Chromosome 8 (position 55924008)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53843684
GRCz11 8 53673414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCAACTACGGCTACCGCTTCAGCAGAGAGTTCGTGGATGCCCGCGAG[C/T]GAGAGAAAACGTTCAGCAAGGGCTCCGCGGAGAGCGCCCGGCAGATGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link