zgc:114121

Ensembl ID:
ENSDARG00000014432
ZFIN ID:
ZDB-GENE-050913-54
Description:
coiled-coil domain-containing protein 77 [Source:RefSeq peptide;Acc:NP_001020649]
Human Orthologue:
CCDC77
Human Description:
coiled-coil domain containing 77 [Source:HGNC Symbol;Acc:28203]
Mouse Orthologue:
Ccdc77
Mouse Description:
coiled-coil domain containing 77 Gene [Source:MGI Symbol;Acc:MGI:1914450]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24591 Essential Splice Site Available for shipment Available now
sa13133 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022021 Essential Splice Site 67 466 None 11
ENSDART00000103208 Essential Splice Site 67 427 None 13
ENSDART00000138485   None 37 None 3
ENSDART00000141767 Essential Splice Site 67 466 None 12
ENSDART00000143564 Essential Splice Site 67 249 None 7

The following transcripts of ENSDARG00000014432 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 3676509)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3426561
GRCz11 25 3552295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGAAGCGGGTGATTCCAGTATTTTGACATCTCTATTGTTTTGTGC[A/T]GCACAAGTTGCAGTGGGAGATTCGCCAGCGTGAGGAGGAGATCGCGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022021 Nonsense 418 466 10 11
ENSDART00000103208 Nonsense 379 427 12 13
ENSDART00000138485   None 37 None 3
ENSDART00000141767 Nonsense 418 466 11 12
ENSDART00000143564   None 249 None 7

The following transcripts of ENSDARG00000014432 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 3668596)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3434474
GRCz11 25 3560208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATCAGACTCCTGCGGCAGAAAGTCAAAGATGTGGAGAAAATTCTCTTC[A/T]AAGTSAGTCGAGTCTCCCTTTCRTCTCTTCTGAAGAAATATATTWATATW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link