zgc:77529

Ensembl ID:
ENSDARG00000014428
ZFIN ID:
ZDB-GENE-040426-2568
Description:
serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit delta isoform [Source:RefSeq pept
Human Orthologue:
PPP2R5D
Human Description:
protein phosphatase 2, regulatory subunit B', delta [Source:HGNC Symbol;Acc:9312]
Mouse Orthologue:
Ppp2r5d
Mouse Description:
protein phosphatase 2, regulatory subunit B (B56), delta isoform Gene [Source:MGI Symbol;Acc:MGI:238

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16844 Nonsense Available for shipment Available now
sa22204 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102694 Nonsense 526 601 16 17
ENSDART00000136262 Nonsense 179 254 6 7
Genomic Location (Zv9):
Chromosome 13 (position 3893065)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4109985
GRCz11 13 4238481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTYATCTGTATGYATGTTTGTGCGTCTGCAGTATATKATGTACAATGAA[G/T]GAGGGATGCCGATATACTCGATGGAGACTGARACCCCGACAGTGRAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102694 Nonsense 570 601 17 17
ENSDART00000136262 Nonsense 223 254 7 7
Genomic Location (Zv9):
Chromosome 13 (position 3889420)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4106340
GRCz11 13 4234836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTTCAGGGAATGAAAGAAATCAAGAAAGACAAGGTGTTGATGAGG[C/T]GAAAGTCTGAGCTGCCGCAGGATGTGTATACTATAAAAGCTCTGGAGGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link