
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:77529
- Ensembl ID:
- ENSDARG00000014428
- ZFIN ID:
- ZDB-GENE-040426-2568
- Description:
- serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit delta isoform [Source:RefSeq pept
- Human Orthologue:
- PPP2R5D
- Human Description:
- protein phosphatase 2, regulatory subunit B', delta [Source:HGNC Symbol;Acc:9312]
- Mouse Orthologue:
- Ppp2r5d
- Mouse Description:
- protein phosphatase 2, regulatory subunit B (B56), delta isoform Gene [Source:MGI Symbol;Acc:MGI:238
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16844 | Nonsense | Available for shipment | Available now |
sa22204 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16844
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102694 | Nonsense | 526 | 601 | 16 | 17 |
ENSDART00000136262 | Nonsense | 179 | 254 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 3893065)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 4109985 GRCz11 13 4238481 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTYATCTGTATGYATGTTTGTGCGTCTGCAGTATATKATGTACAATGAA[G/T]GAGGGATGCCGATATACTCGATGGAGACTGARACCCCGACAGTGRAGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22204
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102694 | Nonsense | 570 | 601 | 17 | 17 |
ENSDART00000136262 | Nonsense | 223 | 254 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 3889420)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 4106340 GRCz11 13 4234836 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGTTTTTCAGGGAATGAAAGAAATCAAGAAAGACAAGGTGTTGATGAGG[C/T]GAAAGTCTGAGCTGCCGCAGGATGTGTATACTATAAAAGCTCTGGAGGCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: