
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-236p22.1
- Ensembl ID:
- ENSDARG00000014391
- ZFIN ID:
- ZDB-GENE-050419-118
- Description:
- Novel sushi domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LVL7]
- Human Orthologue:
- CSMD3
- Human Description:
- CUB and Sushi multiple domains 3 [Source:HGNC Symbol;Acc:19291]
- Mouse Orthologue:
- Csmd3
- Mouse Description:
- CUB and Sushi multiple domains 3 Gene [Source:MGI Symbol;Acc:MGI:2386403]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42822 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42821 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa17497 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42822
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000074570 | None | 353 | None | 9 | |
ENSDART00000143582 | Essential Splice Site | 58 | 429 | 1 | 10 |
- Genomic Location (Zv9):
- Chromosome 16 (position 50774849)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 47628924 GRCz11 16 47564010 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTTGCCAAGCAGACGCCACATGGAGCGGCACTCAACCACGCTGCATAG[G/A]TATATTTACTTTTAAGAACGTTTTCCTCTTATCAATAAATACTTTATCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42821
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000074570 | Essential Splice Site | 16 | 353 | 1 | 9 |
ENSDART00000143582 | Essential Splice Site | 83 | 429 | 2 | 10 |
- Genomic Location (Zv9):
- Chromosome 16 (position 50771505)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 47625580 GRCz11 16 47560666 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCCTGGCACTCCAGAATTCGGCTCTTTGAACAGCAGTCTGGGCTTTAAG[G/A]TAAGAAGCAGTGGAGCTTGGACTGTCTTGGCCTCTTATATCAAAGCCATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17497
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000074570 | Nonsense | 41 | 353 | 2 | 9 |
ENSDART00000143582 | Nonsense | 108 | 429 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 16 (position 50765159)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 47619234 GRCz11 16 47554320 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTGTCAGACGGGCCACTTGTTACTGGGCTCCACCACACGCACRTGTCAG[C/T]AGGATTTGACCTGGAGTGGCTCTCAACCTGAATGCATCCGTGAGTCTCAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Periodontal microbiota: Genome-wide association study of periodontal pathogen colonization. (View Study)
- Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: