vasa

Ensembl ID:
ENSDARG00000014373
ZFIN IDs:
ZDB-GENE-990415-272, ZDB-GENE-990415-272, ZDB-GENE-990415-272
Description:
probable ATP-dependent RNA helicase DDX4 [Source:RefSeq peptide;Acc:NP_571132]
Human Orthologue:
DDX4
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 [Source:HGNC Symbol;Acc:18700]
Mouse Orthologue:
Ddx4
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:102670]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15900 Essential Splice Site Available for shipment Available now
sa6158 Nonsense Mutation detected in F1 DNA During 2018
sa9472 Nonsense Available for shipment Available now
sa18973 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Essential Splice Site 65 700 6 26
ENSDART00000121729 Essential Splice Site 82 715 6 26
ENSDART00000125262 Essential Splice Site 65 688 6 25
ENSDART00000128866 Essential Splice Site 81 716 7 27
Genomic Location (Zv9):
Chromosome 10 (position 6557550)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6934178
GRCz11 10 6892878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGAGGATCACGAGGAGGCAGAGGAGGCTTTAGCGGTTTTAAATCAGG[T/C]GAAATTTATATGCATGCTTGATTTGAAGCTGTCAGTTTAATCTGGTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Nonsense 205 700 16 26
ENSDART00000121729 Nonsense 219 715 16 26
ENSDART00000125262 Nonsense 193 688 15 25
ENSDART00000128866 Nonsense 221 716 17 27
Genomic Location (Zv9):
Chromosome 10 (position 6561271)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6937899
GRCz11 10 6896599
KASP Assay ID:
554-5272.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCCATTTTAWTGTTTTCCTGTTTGTTCAGTCACAACTGCAGACAAGT[T/A]GGATCAAGAAGGAAGTGAAAATGCAGGTGGGCANNATGTTATACATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
Genomic Location (Zv9):
Chromosome 10 (position 6569553)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6946181
GRCz11 10 6904881
KASP Assay ID:
2260-2843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTTATTTGTAGGGAGGATCCTTYAAGAGCGATGAGCCGCCACCATCA[C/T]AAACATCTGCCCCGAGYGCAGCAGCTGCTGCAGACGATGAGGAATGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
ENSDART00000105384 Nonsense 684 700 26 26
ENSDART00000121729 Nonsense 699 715 26 26
ENSDART00000125262 Nonsense 672 688 25 25
ENSDART00000128866 Nonsense 700 716 27 27
Genomic Location (Zv9):
Chromosome 10 (position 6569553)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6946181
GRCz11 10 6904881
KASP Assay ID:
2260-2843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTTATTTGTAGGGAGGATCCTTCAAGAGCGATGAGCCGCCACCATCA[C/T]AAACATCTGCCCCGAGCGCAGCAGCTGCTGCAGACGATGAGGAATGGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link